ID: 1170629946_1170629956

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 1170629946 1170629956
Species Human (GRCh38) Human (GRCh38)
Location 20:18057519-18057541 20:18057565-18057587
Sequence CCCCGCGCGCGCTCACCTGGGAT CCGGGAGCTCATCCCAGCTGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 55} {0: 1, 1: 0, 2: 0, 3: 12, 4: 184}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!