ID: 1170722738_1170722749

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 1170722738 1170722749
Species Human (GRCh38) Human (GRCh38)
Location 20:18898166-18898188 20:18898199-18898221
Sequence CCCAAATCCATGTGTTTAAATGC TGTGATGGTATTAGGAGGTGGGG
Strand - +
Off-target summary No data {0: 112, 1: 652, 2: 1634, 3: 2609, 4: 3219}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!