ID: 1170813897_1170813906

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 1170813897 1170813906
Species Human (GRCh38) Human (GRCh38)
Location 20:19696903-19696925 20:19696924-19696946
Sequence CCAGACAAGGTGGGACTTCCAGT GTGGCAATGGGGAAGGAGGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 250} {0: 1, 1: 1, 2: 11, 3: 107, 4: 1084}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!