ID: 1170941818_1170941827

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 1170941818 1170941827
Species Human (GRCh38) Human (GRCh38)
Location 20:20854338-20854360 20:20854368-20854390
Sequence CCCTTCTTGGCATTCAGAAATTC CCACAGGAAGTATGGGCAAGGGG
Strand - +
Off-target summary {0: 1, 1: 2, 2: 3, 3: 51, 4: 443} {0: 1, 1: 0, 2: 1, 3: 18, 4: 189}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!