ID: 1171521171_1171521174

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 1171521171 1171521174
Species Human (GRCh38) Human (GRCh38)
Location 20:25774956-25774978 20:25774972-25774994
Sequence CCGCTTGCGACACCGGGGCCGCC GGCCGCCTGAACCTCCGCCAGGG
Strand - +
Off-target summary {0: 6, 1: 2, 2: 0, 3: 7, 4: 43} {0: 4, 1: 4, 2: 1, 3: 6, 4: 112}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!