ID: 1171892016_1171892023

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 1171892016 1171892023
Species Human (GRCh38) Human (GRCh38)
Location 20:30725278-30725300 20:30725304-30725326
Sequence CCTCTCAGGGGCCATGGTGGTTG TCTCCGTGGAAACTGGGATGGGG
Strand - +
Off-target summary No data {0: 6, 1: 1, 2: 1, 3: 17, 4: 177}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!