ID: 1172100883_1172100897

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 1172100883 1172100897
Species Human (GRCh38) Human (GRCh38)
Location 20:32483536-32483558 20:32483579-32483601
Sequence CCAGGAGGAGGGCCCAGGCGAGC CGCCGCGGCCCGGAGGAAGGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 28, 4: 337} {0: 1, 1: 0, 2: 1, 3: 73, 4: 4274}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!