ID: 1172132521_1172132527

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 1172132521 1172132527
Species Human (GRCh38) Human (GRCh38)
Location 20:32665058-32665080 20:32665074-32665096
Sequence CCAAGCTGCCAAGTAAGTTCCCC GTTCCCCTGATGGAGCTTGGGGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!