ID: 1172146785_1172146798

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 1172146785 1172146798
Species Human (GRCh38) Human (GRCh38)
Location 20:32762832-32762854 20:32762878-32762900
Sequence CCGGGTTGGAGACCCGGCTGGGT GGACCCTGCTTGGGGTGGAACGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 139} {0: 1, 1: 0, 2: 1, 3: 21, 4: 232}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!