ID: 1172222419_1172222423

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 1172222419 1172222423
Species Human (GRCh38) Human (GRCh38)
Location 20:33283104-33283126 20:33283121-33283143
Sequence CCACAAATATTTACCTTGGAGAC GGAGACCTCGGCCTGGTCTGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 8, 4: 170} {0: 1, 1: 0, 2: 0, 3: 13, 4: 175}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!