ID: 1172390292_1172390301

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 1172390292 1172390301
Species Human (GRCh38) Human (GRCh38)
Location 20:34560938-34560960 20:34560975-34560997
Sequence CCGCCGCAGGAAGGCATAGAAGT AGGATCTGGGGGGAGAGAGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 86} {0: 1, 1: 0, 2: 12, 3: 74, 4: 872}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!