ID: 1172392998_1172393005

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 1172392998 1172393005
Species Human (GRCh38) Human (GRCh38)
Location 20:34578977-34578999 20:34579025-34579047
Sequence CCACTTTCCCTTCAGAGCCTCAG AAAAATCCAGTCCAATCAGAAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 12, 4: 211}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!