ID: 1172474514_1172474522

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 1172474514 1172474522
Species Human (GRCh38) Human (GRCh38)
Location 20:35226832-35226854 20:35226873-35226895
Sequence CCTGGGCGGCTGCTGCTGCTGCT CCTCCCGGGCGCCGCGCGGGCGG
Strand - +
Off-target summary {0: 1, 1: 8, 2: 53, 3: 363, 4: 1083} {0: 1, 1: 0, 2: 1, 3: 30, 4: 231}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!