ID: 1172547257_1172547258

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 1172547257 1172547258
Species Human (GRCh38) Human (GRCh38)
Location 20:35771824-35771846 20:35771837-35771859
Sequence CCTGCTAGGGCGCGGGCCTGTTT GGGCCTGTTTCCCGCGCGTCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 31} {0: 1, 1: 0, 2: 0, 3: 1, 4: 38}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!