ID: 1172583169_1172583175

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 1172583169 1172583175
Species Human (GRCh38) Human (GRCh38)
Location 20:36064532-36064554 20:36064545-36064567
Sequence CCGACCCCGTAGCGGGGACTCTG GGGGACTCTGCTGCTGTGCGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 148} {0: 1, 1: 0, 2: 0, 3: 16, 4: 229}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!