ID: 1172930894_1172930914

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 1172930894 1172930914
Species Human (GRCh38) Human (GRCh38)
Location 20:38585914-38585936 20:38585967-38585989
Sequence CCTAGCCTCAGGCAAGGCTGCAG CTGGGTCAGGGGTAGGAGACAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 49, 4: 444} {0: 1, 1: 0, 2: 1, 3: 48, 4: 449}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!