ID: 1173079774_1173079778

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 1173079774 1173079778
Species Human (GRCh38) Human (GRCh38)
Location 20:39854605-39854627 20:39854646-39854668
Sequence CCCTTGGTAATTCTACAGTCTGA CTTAGAGACTTCATATTAAGTGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!