ID: 1173228648_1173228658

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 1173228648 1173228658
Species Human (GRCh38) Human (GRCh38)
Location 20:41177142-41177164 20:41177194-41177216
Sequence CCCTTGCAGGCTCCTTGTTCTCC CAGACCAGGGACAAGTAGACTGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 4, 3: 23, 4: 255} {0: 1, 1: 0, 2: 2, 3: 12, 4: 167}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!