ID: 1173498027_1173498040

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 1173498027 1173498040
Species Human (GRCh38) Human (GRCh38)
Location 20:43533217-43533239 20:43533269-43533291
Sequence CCTTGCCATCTGTCTCCCTCTCA CCATGCTTTCAGAGGATGGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 79, 4: 647} {0: 1, 1: 0, 2: 0, 3: 16, 4: 217}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!