ID: 1173522404_1173522414

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 1173522404 1173522414
Species Human (GRCh38) Human (GRCh38)
Location 20:43709784-43709806 20:43709808-43709830
Sequence CCCTCTCCCTTCTGTTTCCCCCG GCCCCTGACTTGGACCTGCAGGG
Strand - +
Off-target summary {0: 1, 1: 2, 2: 13, 3: 181, 4: 705} {0: 1, 1: 0, 2: 0, 3: 15, 4: 191}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!