ID: 1173583011_1173583022

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 1173583011 1173583022
Species Human (GRCh38) Human (GRCh38)
Location 20:44160453-44160475 20:44160478-44160500
Sequence CCGCGTGTGCACGGTGGCCTGGG GGCAAGGGCGGGAGTGGGCAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 165} {0: 1, 1: 0, 2: 3, 3: 89, 4: 783}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!