ID: 1173681505_1173681524

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 1173681505 1173681524
Species Human (GRCh38) Human (GRCh38)
Location 20:44885602-44885624 20:44885651-44885673
Sequence CCCCTCCCGTGGGGCCGTGGCAA ACACGGTTTGGGGCGGGGCGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 109} {0: 1, 1: 0, 2: 1, 3: 24, 4: 353}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!