ID: 1173687396_1173687414

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 1173687396 1173687414
Species Human (GRCh38) Human (GRCh38)
Location 20:44933147-44933169 20:44933198-44933220
Sequence CCCAGGTGCCACGCACGGTGCCT AGGGCCAAGGGGAATGGGGGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 24, 4: 306} {0: 1, 1: 0, 2: 5, 3: 79, 4: 673}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!