ID: 1173689440_1173689446

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 1173689440 1173689446
Species Human (GRCh38) Human (GRCh38)
Location 20:44948692-44948714 20:44948723-44948745
Sequence CCTGAAATGCCCCAGGCCAGCAG GAGATACCTGTTGCTGTACGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 27, 4: 225} {0: 1, 1: 0, 2: 0, 3: 2, 4: 37}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!