ID: 1173751444_1173751453

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 1173751444 1173751453
Species Human (GRCh38) Human (GRCh38)
Location 20:45479938-45479960 20:45479979-45480001
Sequence CCAGATAAGGAGGGTTCCTGCCC TCCCCAGCTCGGCCTCTGTCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 5, 4: 103} {0: 1, 1: 0, 2: 1, 3: 23, 4: 234}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!