ID: 1173798080_1173798095

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 1173798080 1173798095
Species Human (GRCh38) Human (GRCh38)
Location 20:45876597-45876619 20:45876649-45876671
Sequence CCAAAGTGCTGGGGTTATAGGCA TCTTATCTTTATAAGGGGTGGGG
Strand - +
Off-target summary {0: 206, 1: 12486, 2: 117102, 3: 246504, 4: 241017} {0: 1, 1: 0, 2: 0, 3: 16, 4: 197}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!