ID: 1173802399_1173802411

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 1173802399 1173802411
Species Human (GRCh38) Human (GRCh38)
Location 20:45902563-45902585 20:45902606-45902628
Sequence CCGCAGCTCCAGCTTCAATGGGG TGGGGGATGAGCAGCAGGGGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 17, 4: 194} {0: 1, 1: 1, 2: 2, 3: 94, 4: 719}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!