ID: 1173808694_1173808699

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 1173808694 1173808699
Species Human (GRCh38) Human (GRCh38)
Location 20:45942854-45942876 20:45942888-45942910
Sequence CCTTCCACCTTAGCCTTCCAAAG CAGATGTGAGCCACTACGCCTGG
Strand - +
Off-target summary No data {0: 10, 1: 844, 2: 14178, 3: 68066, 4: 151322}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!