ID: 1173827898_1173827911

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 1173827898 1173827911
Species Human (GRCh38) Human (GRCh38)
Location 20:46058852-46058874 20:46058900-46058922
Sequence CCAGCCGCCTTCTCCGTGCTCTG GGCCTCTAGCTCCGTCTCCCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 20, 4: 270} {0: 1, 1: 0, 2: 2, 3: 202, 4: 5975}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!