ID: 1173920633_1173920640

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 1173920633 1173920640
Species Human (GRCh38) Human (GRCh38)
Location 20:46742340-46742362 20:46742358-46742380
Sequence CCCTTGCTGGCCAGAGAGGTGCT GTGCTAGGACAGAGGATGGGAGG
Strand - +
Off-target summary No data {0: 1, 1: 1, 2: 2, 3: 25, 4: 270}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!