ID: 1174294981_1174295001

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 1174294981 1174295001
Species Human (GRCh38) Human (GRCh38)
Location 20:49539539-49539561 20:49539588-49539610
Sequence CCCCACCCACTGGGGCCCCCATG GGGCCAGTTTGGGGAGCAGCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 27, 3: 23, 4: 312} {0: 1, 1: 1, 2: 3, 3: 34, 4: 426}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!