ID: 1174354332_1174354335

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 1174354332 1174354335
Species Human (GRCh38) Human (GRCh38)
Location 20:49988192-49988214 20:49988219-49988241
Sequence CCACAGGACTTTGATGAAGACCA CTGGTTCTGTGTCCTCTGCCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 17, 4: 168} {0: 1, 1: 0, 2: 2, 3: 63, 4: 482}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!