ID: 1174394360_1174394372

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 1174394360 1174394372
Species Human (GRCh38) Human (GRCh38)
Location 20:50237553-50237575 20:50237580-50237602
Sequence CCGCAGGGGCCAGCATGACCCCA CTGTGGGTATGGATGGTGGCTGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!