ID: 1174444420_1174444437

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 1174444420 1174444437
Species Human (GRCh38) Human (GRCh38)
Location 20:50581008-50581030 20:50581058-50581080
Sequence CCTTGTGAACCCTACCCTGGGTG GGGGGTGACAAGTGGACTTCAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 16, 4: 112}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!