ID: 1174584699_1174584701

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 1174584699 1174584701
Species Human (GRCh38) Human (GRCh38)
Location 20:51599093-51599115 20:51599119-51599141
Sequence CCATCTTCATTCTGCTTCTGCTG ACCTCTAAAACTTTCTGACGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 9, 3: 126, 4: 1048} {0: 1, 1: 0, 2: 0, 3: 7, 4: 61}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!