ID: 1174727856_1174727858 |
View in Genome Browser |
Spacer: 9 |
Left Crispr | Right Crispr | |
---|---|---|
Crispr ID | 1174727856 | 1174727858 |
Species | Human (GRCh38) | Human (GRCh38) |
Location | 20:52882249-52882271 | 20:52882281-52882303 |
Sequence | CCCACTGAATTATCTTGGCACTT | ATGAATTGACCATATATGAGTGG |
Strand | - | + |
Off-target summary | {0: 2, 1: 7, 2: 49, 3: 204, 4: 756} | No data |
Status | Not started |
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer | Left Crispr | Right Crispr | ||||||
---|---|---|---|---|---|---|---|---|
Location | Sequence | Mismatches | Strand | Location | Sequence | Mismatches | Strand | |
No off target data available for this pair! |