ID: 1174727856_1174727858

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 1174727856 1174727858
Species Human (GRCh38) Human (GRCh38)
Location 20:52882249-52882271 20:52882281-52882303
Sequence CCCACTGAATTATCTTGGCACTT ATGAATTGACCATATATGAGTGG
Strand - +
Off-target summary {0: 2, 1: 7, 2: 49, 3: 204, 4: 756} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!