ID: 1175036251_1175036257

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 1175036251 1175036257
Species Human (GRCh38) Human (GRCh38)
Location 20:56004108-56004130 20:56004135-56004157
Sequence CCGGCAGCGTGAGGACCAGCAGC CCGGCACCGCGGACAGCGCCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 28, 4: 262} {0: 1, 1: 0, 2: 5, 3: 35, 4: 207}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!