ID: 1175199301_1175199310

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 1175199301 1175199310
Species Human (GRCh38) Human (GRCh38)
Location 20:57266745-57266767 20:57266795-57266817
Sequence CCCCAGCTGTGCCCAGTGGGTTC ATGTTTACTGAGTGCCCACGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 19, 4: 269} {0: 1, 1: 0, 2: 5, 3: 37, 4: 209}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!