ID: 1175238104_1175238116

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 1175238104 1175238116
Species Human (GRCh38) Human (GRCh38)
Location 20:57526664-57526686 20:57526692-57526714
Sequence CCTGCAGGGGGCACTGAGACCTG GAATGGATAAGGAGGGAGGAGGG
Strand - +
Off-target summary No data {0: 1, 1: 2, 2: 11, 3: 124, 4: 1268}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!