ID: 1175349816_1175349820

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 1175349816 1175349820
Species Human (GRCh38) Human (GRCh38)
Location 20:58309798-58309820 20:58309814-58309836
Sequence CCACGCGGCTGGCAGCGGACAGG GGACAGGCCGGACCTACGGCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 99} {0: 1, 1: 0, 2: 0, 3: 8, 4: 72}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!