|
Left Crispr |
Right Crispr |
Crispr ID |
1175616515 |
1175616520 |
Species |
Human (GRCh38) |
Human (GRCh38) |
Location |
20:60404613-60404635
|
20:60404640-60404662
|
Sequence |
CCAGCTACTGGAGAAGCTGAGGC |
AATAAGTTGAACCTGGGAAGCGG |
Strand |
- |
+ |
Off-target summary |
{0: 26, 1: 1191, 2: 23216, 3: 220752, 4: 267695} |
No data |
Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
No off target data available for this pair!
|