ID: 1175616515_1175616525

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 1175616515 1175616525
Species Human (GRCh38) Human (GRCh38)
Location 20:60404613-60404635 20:60404659-60404681
Sequence CCAGCTACTGGAGAAGCTGAGGC GCGGGGGTTGCAGTGAGCTGAGG
Strand - +
Off-target summary {0: 26, 1: 1191, 2: 23216, 3: 220752, 4: 267695} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!