ID: 1175715738_1175715745

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 1175715738 1175715745
Species Human (GRCh38) Human (GRCh38)
Location 20:61253174-61253196 20:61253193-61253215
Sequence CCTCGGCGGGGCTGGAGCCTGCG TGCGTGTCCGGCGGGGCCCCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 23, 4: 273} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!