ID: 1175808514_1175808522

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 1175808514 1175808522
Species Human (GRCh38) Human (GRCh38)
Location 20:61844981-61845003 20:61845003-61845025
Sequence CCCAGGTCGCTGGGCACTGTCCC CCCGTCTAATTCAGCAGGGTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 25, 4: 239} {0: 1, 1: 0, 2: 0, 3: 2, 4: 48}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!