ID: 1175903335_1175903342

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 1175903335 1175903342
Species Human (GRCh38) Human (GRCh38)
Location 20:62368401-62368423 20:62368427-62368449
Sequence CCGGGGGGCTGGGTGGGTTTGTG CACTGGCCAGCCGGTTCTGGTGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 8, 4: 149}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!