ID: 1175962163_1175962169

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 1175962163 1175962169
Species Human (GRCh38) Human (GRCh38)
Location 20:62642655-62642677 20:62642672-62642694
Sequence CCGGGGGGATGCGCGCGGGGGCG GGGGCGGGAGGCCTGGGCACCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 22, 4: 214} {0: 1, 1: 0, 2: 4, 3: 93, 4: 728}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!