ID: 1176065521_1176065526

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 1176065521 1176065526
Species Human (GRCh38) Human (GRCh38)
Location 20:63192445-63192467 20:63192473-63192495
Sequence CCCACCGCGCCCGGCTGAGGCGC TTTTATTTTTTTTTTTGAGACGG
Strand - +
Off-target summary No data {0: 251, 1: 88149, 2: 69780, 3: 82890, 4: 153606}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!