|
Left Crispr |
Right Crispr |
Crispr ID |
1176065523 |
1176065526 |
Species |
Human (GRCh38) |
Human (GRCh38) |
Location |
20:63192449-63192471
|
20:63192473-63192495
|
Sequence |
CCGCGCCCGGCTGAGGCGCTTCT |
TTTTATTTTTTTTTTTGAGACGG |
Strand |
- |
+ |
Off-target summary |
No data |
{0: 251, 1: 88149, 2: 69780, 3: 82890, 4: 153606} |
Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
No off target data available for this pair!
|