ID: 1176066841_1176066846

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 1176066841 1176066846
Species Human (GRCh38) Human (GRCh38)
Location 20:63202215-63202237 20:63202238-63202260
Sequence CCGGGCCACCTGGTCTAAGTACG GCACCAAGGACACATCTGCATGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 0, 3: 2, 4: 35} {0: 1, 1: 0, 2: 0, 3: 20, 4: 159}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!