ID: 1176088621_1176088630

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 1176088621 1176088630
Species Human (GRCh38) Human (GRCh38)
Location 20:63309242-63309264 20:63309266-63309288
Sequence CCTGACCCAGTCTCCATGGAGAC CCCACCGCAGGTGGCCCCGTCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 18, 4: 195} {0: 1, 1: 0, 2: 0, 3: 8, 4: 110}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!